p426 snr52p grna  (Addgene inc)

Journal: Molecular Therapy Oncology

Article Title: CAR-T cells directed toward PD-L1 demonstrate potent, antigen-specific activity against cholangiocarcinoma: A proof of concept study

doi: 10.1016/j.omton.2026.201209

Figure Lengend Snippet: Generation of PD-L1 CAR-T and validation of PD-L1 expression in target cells (A) Schematic of the second-generation PD-L1 CAR construct containing an anti-PD-L1 scFv, CD4 transmembrane domain, and 4-1BB/CD3ζ signaling domains and tEGFR safety switch. (B) Flow cytometry results of PD-L1 expression in HuCCT1, HuCCT1-PD-L1 KO, and SNU1079 cells. (C) Characterization of non-CAR-T and CAR-T showing 98.8% and 98.6% CD3 expression and 1.03% and 28% EGFR expression, respectively.

Article Snippet: Cas9 was combined with multi-guide RNA targeting PD-L1 (Synthego, Redwood City, CA, USA) in NEB buffer (New England Biolabs) at a 12:1 ratio and incubated to form RNP complexes.

Techniques: Biomarker Discovery, Expressing, Construct, Flow Cytometry

Journal: Molecular Therapy Oncology

Article Title: CAR-T cells directed toward PD-L1 demonstrate potent, antigen-specific activity against cholangiocarcinoma: A proof of concept study

doi: 10.1016/j.omton.2026.201209

Figure Lengend Snippet: PD-L1 CAR-T delay tumor progression and reduce tumor burden in vivo (A) Longitudinal bioluminescent imaging of mice with orthotopic HuCCT1 tumors treated with PBS as a control, Non-CAR-T, or CAR-T at 7 and 14 days. (B) Quantification of total bioluminescent signal confirming significantly reduced tumor burden in CAR-T treated animals compared with both control groups. Results are reported as mean ± standard deviation (SD). Two-way ANOVA with Tukey’s multiple comparisons between tumor control and CAR-T are represented by ( p values: ∗∗ ≤0.01), and between non-CAR-T and CAR-T by ( p values: # # ≤ 0.01). n = 6 biological replicates at all days and time points with the exception of non-CAR-T week 9, where n = 5 biological replicates.

Article Snippet: Cas9 was combined with multi-guide RNA targeting PD-L1 (Synthego, Redwood City, CA, USA) in NEB buffer (New England Biolabs) at a 12:1 ratio and incubated to form RNP complexes.

Techniques: In Vivo, Imaging, Control, Standard Deviation

Journal: Molecular Therapy Oncology

Article Title: CAR-T cells directed toward PD-L1 demonstrate potent, antigen-specific activity against cholangiocarcinoma: A proof of concept study

doi: 10.1016/j.omton.2026.201209

Figure Lengend Snippet: Antigen-specific degranulation and granzyme B released by PD-L1 CAR-T (A) CD8 + T cell degranulation in response to HuCCT1 wild-type (WT) or PD-L1 knockout (KO) cells by flow cytometry after CAR-T co-culture at 6 h. (B) CD4 + T cell degranulation under the same conditions, showing CAR-T-mediated activity against WT but not KO cells. (C) Degranulation of CD8 + and CD4 + T cells in response to SNU1079 cells by flow cytometry after CART co-culture at 6 h compared with non-CAR-T controls. (D) Granzyme B release in HuCCT1 WT and KO cells following co-culture by ELISA after 72 h n = 3 technical replicates. Two-way ANOVA with Tukey’s multiple comparisons test. ∗∗∗∗ p value ≤ 0.0001. Results are reported as mean ± standard deviation (SD).

Article Snippet: Cas9 was combined with multi-guide RNA targeting PD-L1 (Synthego, Redwood City, CA, USA) in NEB buffer (New England Biolabs) at a 12:1 ratio and incubated to form RNP complexes.

Techniques: Knock-Out, Flow Cytometry, Co-Culture Assay, Activity Assay, Enzyme-linked Immunosorbent Assay, Standard Deviation

Journal: Molecular Therapy Oncology

Article Title: CAR-T cells directed toward PD-L1 demonstrate potent, antigen-specific activity against cholangiocarcinoma: A proof of concept study

doi: 10.1016/j.omton.2026.201209

Figure Lengend Snippet: CAR-T release cytotoxic effector molecules and reduce tumor cell viability in an antigen-dependent manner (A and B) Granzyme B and perforin release from CAR-T and non-transduced T cells co-cultured with HuCCT1 (A) or SNU1079 (B) cells at 1:1 and 2:1 effector-to-target (E:T) ratios. n = 3 technical replicates. One-way ANOVA with Tukey’s multiple comparisons test. (C) Luciferase viability assay of HuCCT1, PD-L1 knockout HuCCT1, or SNU1079 cells at 1:1 and 2:1 effector-to-target after 24 and 48 h. n = 6 technical replicates. One-way ANOVA with Tukey’s multiple comparisons test. ∗ p value ≤ 0.05, ∗∗∗∗ p value ≤ 0.0001. Results are reported as mean ± standard deviation (SD).

Article Snippet: Cas9 was combined with multi-guide RNA targeting PD-L1 (Synthego, Redwood City, CA, USA) in NEB buffer (New England Biolabs) at a 12:1 ratio and incubated to form RNP complexes.

Techniques: Cell Culture, Luciferase, Viability Assay, Knock-Out, Standard Deviation

Journal: Molecular Therapy Oncology

Article Title: CAR-T cells directed toward PD-L1 demonstrate potent, antigen-specific activity against cholangiocarcinoma: A proof of concept study

doi: 10.1016/j.omton.2026.201209

Figure Lengend Snippet: PD-L1 CAR-T disrupt and kill tumor cells in multicellular CSFE spheroids (A) Brightfield images of HuCCT1 and SNU1079 CSFE spheroids following 24 h co-culture with non-CAR-T or CAR-T at 1:1 or 2:1 effector-to-target (E:T) ratios. Quantification of spheroid area is shown. n = 3 technical replicates. One-way ANOVA with Tukey’s multiple comparisons test. Scale bar is 300 µm (B) Live/dead staining (calcein-AM/propidium iodide) and luciferase viability assays of spheroids under the same conditions. n = 3 technical replicates. One-way ANOVA with Tukey’s multiple comparisons test. ∗ p value ≤ 0.05, ∗∗ p value ≤ 0.01, ∗∗∗ p value ≤ 0.001, ∗∗∗∗ p value ≤ 0.0001. Results are reported as mean ± standard deviation (SD). Scale bar is 100 µm.

Article Snippet: Cas9 was combined with multi-guide RNA targeting PD-L1 (Synthego, Redwood City, CA, USA) in NEB buffer (New England Biolabs) at a 12:1 ratio and incubated to form RNP complexes.

Techniques: Co-Culture Assay, Staining, Luciferase, Standard Deviation

Journal: Molecular Therapy Oncology

Article Title: CAR-T cells directed toward PD-L1 demonstrate potent, antigen-specific activity against cholangiocarcinoma: A proof of concept study

doi: 10.1016/j.omton.2026.201209

Figure Lengend Snippet: Gemcitabine upregulates PD-L1 and enhances CAR-T cytotoxicity in HuCCT1 cells (A) Schematic of experimental design for gemcitabine pretreatment. (B) Flow cytometry showing increased PD-L1 surface expression in HuCCT1 cells after Gem treatment, with maximal induction at 0.2 μM for 48 h. n = 3 technical replicates. One-way ANOVA with Tukey’s multiple comparisons test. (C) Luciferase-based viability assays at both effector-to-target (E:T) ratios and at 24 and 48 h time points. n = 6 technical replicates, two-way ANOVA with Šídák’s multiple comparisons test. (D) Representative live/dead staining of HuCCT1 CSFE spheroids under the same conditions. ∗∗ p value ≤ 0.01, ∗∗∗ p value ≤ 0.001, ∗∗∗∗ p value ≤ 0.0001. Results are reported as mean ± standard deviation (SD). Scale bar is 50 µm.

Article Snippet: Cas9 was combined with multi-guide RNA targeting PD-L1 (Synthego, Redwood City, CA, USA) in NEB buffer (New England Biolabs) at a 12:1 ratio and incubated to form RNP complexes.

Techniques: Flow Cytometry, Expressing, Luciferase, Staining, Standard Deviation

Journal: Molecular Therapy Oncology

Article Title: CAR-T cells directed toward PD-L1 demonstrate potent, antigen-specific activity against cholangiocarcinoma: A proof of concept study

doi: 10.1016/j.omton.2026.201209

Figure Lengend Snippet: Gemcitabine upregulates PD-L1 and enhances CAR-T cytotoxicity in SNU1079 cells (A) Schematic depicting Gemcitabine pretreatment. (B) Flow cytometry showing Gemcitabine-induced PD-L1 upregulation in SNU1079 cells, with maximal effect at 0.2 μM for 48 h. n = 3 technical replicates. One-way ANOVA with Tukey’s multiple comparisons test. (C) Luciferase-based viability assays at both effector-to-target (E:T) ratios and at 24 and 48 h time points. n = 6 technical replicates. Two-way ANOVA with Šídák’s multiple comparisons test. (D) Representative live/dead staining of SNU1079 CSFE spheroids under the same conditions. p value∗ ≤ 0.05, p value∗∗ ≤ 0.01, p value∗∗∗∗ ≤ 0.0001. Results are reported as mean ± standard deviation (SD). Scale bar is 50 µm.

Article Snippet: Cas9 was combined with multi-guide RNA targeting PD-L1 (Synthego, Redwood City, CA, USA) in NEB buffer (New England Biolabs) at a 12:1 ratio and incubated to form RNP complexes.

Techniques: Flow Cytometry, Luciferase, Staining, Standard Deviation

Journal: bioRxiv

Article Title: Pyridoxine supplementation confers protection against SGPL1 R222Q variant sphingosine phosphate lyase insufficiency syndrome

doi: 10.64898/2026.05.11.724358

Figure Lengend Snippet: (A) A single-guide RNA (sgRNA) containing a 20 bp target sequence, 5’ GATGGCCTGCAAAGCTTACC 3’ (Synthego) of exon 7. To introduce the mutant sequence, we designed a single-stranded 199-base oligodeoxynucleotide (SPLIS ssOligo) containing the G-to-A SPLIS mutation and a silent point mutation to create a SphI restriction enzyme site for screening: 5’AGGCTGTACCTCCTGATACCCATCCTTAACTTACTCTGGTTTCTTTTCTTCACATAG GTGACTTCTGGGGGAACGGAAAGCATCCTGATGGCATGCAAAGCTTACCAGGACTT GGCGTTAGAGAAGGGGATCAAAACTCCAGAAATGTATGGATGTGTGTGTTTGTTTCC CTTCTGATATTGTCTATTTGTGGCAGCAC 3’ (Ultramer DNA, IDT). The C57BL/6J strain was used as an embryo donor. Fertilized oocytes were injected with Cas9 protein (TrueCut Cas9 protein V2, Thermofisher), the sgRNA, and the SPLIS ssOligo and transferred to the oviducts of pseudopregnant female mice. (B) Mice were genotyped by PCR. The resulting PCR product (443 bp) was digested with SphI to detect the mutant sequence. After digestion, the WT allele yielded a 443 bp fragment; the SPLIS-modified allele yielded 275 bp and 167 bp bands. We detected 1 founder whose PCR fragment was digested by SphI (out of 99 offspring screened). Sequences of the undigested PCR fragments were determined after TOPO TA cloning (ThermoFisher) by Sanger sequencing. The founder female carried one allele containing R222Q mutation and SphI restriction site and one allele with a 38-bp deletion in exon 7, resulting in a frameshift and premature stop codon (A, B). (C) When mated with a WT male, the founder produced 4 pups, 2 Sgpl1 R222Q/WT and 2 Sgpl1 del/WT, segregating the 2 alleles.

Article Snippet: We designed a single-guide RNA (sgRNA) containing a 20 bp target sequence, 5’ GATGGCCTGCAAAGCTTACC 3’ (Synthego), on mouse exon 7.

Techniques: Sequencing, Introduce, Mutagenesis, Injection, Modification, TA Cloning, Produced